- Haplogroup R1b (Y-DNA)
Infobox haplogroup
name =R1b
origin-date =less than 18,500 years BP [Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree]
origin-place =Central Asia
ancestor =Haplogroup R1
descendants =
mutations =M343
members=People ofAtlantic Europe (Welsh 89%, Basque 88%, Irish 81%, Northern Portuguese 81%Portugal , Catalan 79%, Scottish 77%, English 75%, Dutch 70%, etc.) . Inhuman genetics , Haplogroup R1b is the most frequent Y-chromosomehaplogroup inWestern Europe .Its frequency is highest in
Western Europe , especially inAtlantic Europe (and due to European emigration, inNorth America ,South America , andAustralia ). In southernEngland , the frequency of R1b is about 70%, and in parts of north and westernEngland ,Spain ,Portugal ,France ,Wales ,Scotland andIreland , the frequency of R1b is greater than 90%.fact|date=December 2007.It is also present at lower frequencies throughout Eastern Europe, although diversity is higher than in western Europe, suggesting an ancient migration of R1b from the east. [http://www.worldfamilies.net/Tools/r1b_ydna_in_europe Variations of R1b Ydna in Europe: Distribution and Origins] ]
R1b is also found at various frequencies in many different populations near the
Ural mountains andCentral Asia , its likely region of origin.It also appears in
North Africa where its frequency surpasses 10% in some parts of Algeria [ [http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed&uid=17909833&cmd=showdetailview&indexed=google Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample] ] .Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004. [cite journal |title=Excavating Y-chromosome haplotype strata in Anatolia |last=Cinnioglu |first=Cengiz |coauthors="et al" |doi=10.1007/s00439-003-1031-4 |journal=Human Genetics |volume=114 |issue=2 |pages=127–148 |month=January | year=2004 |accessdate=2007-12-13] From 2002 to 2005, R1b was defined by the presence of SNP P25; prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18. [cite web |url=http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html |title=YCC NRY Tree 2002 |author=Y Chromosome Consortium |date=2002-01-18 |accessdate=2007-12-13]Origins
I. Dupandunlop argued in
2002 [ [http://mbe.oxfordjournals.org/cgi/content/full/21/7/1361. I. Dupandunlop et al., "Estimating the impact of prehistoric admixture in the genome of Europeans". Society for Molecular Biology and Evolution, 2002] ] that Basque alleles and hence haplogroup R1b1b2 were the most representative of Paleolithic European population. In this she followed previous research done fundamentally onmitochondrial DNA . Many other authors have followed her conclusions for further research, assuming thereafter that R1b1b2 is of Paleolithic origin.Based on R1b frequency and variability, most researchers considered the genetic pool of western European countries - Belgium, France, Germany, Ireland, the Netherlands, north Italy, Portugal, Spain and United Kingdom - to date back to Paleolithic times, noticing the overlap between R1b previously estimated age (about 25,000 to 30,000 years ago) and the European Upper Paleolithic. The hypothesis met apparent confirmation in the fact that the
Basques , who traditionally have been considered descendants of the European Paleolithic strata, have one of the highest frequencies of R1b in the world.However, linguistic-historical studies performed by paleo-Hispanists, and also some genetic research [ [http://www.nature.com/ejhg/journal/v13/n12/full/5201482a.html S. Alonso et al., "The place of the Basques in the European Y-chromosome diversity landscape". Nature, 2005] ] , the latter focusing on the lower R1b1b2 diversity among Basques, disputed either their assumed remote Hispanic origins or their position as the group who has best conserved their Paleolithic European genetic ancestry, and deny Basque territory represents a mayor focus of expansion: Quote|"Contrary to previous suggestions, we do not observe any particular link between Basques and Celtic populations beyond that provided by the Paleolithic ancestry common to European populations, nor we find evidence supporting Basques as the focus of major population expansions"
Despite lower frequencies, diversity is higher in Eastern Europe than in the west. Analysis indicates that all European variants of R1b shared an existence in Kazakhstan before migrating to Russia and then splitting into two major migrations, primarily along rivers and coastlines.
Diversity peaks also occur in other low frequency areas, especially northern Croatia. [http://mbe.oxfordjournals.org/cgi/content/full/22/10/1964] Pericic et al. - High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations, Mol. Biol. Evol. vol.22,issue 10, p.1964–75, fig. 6]
By
2008 , T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP. [ [http://www.genome.org/cgi/content/abstract/gr.7172008v1 Tatiana M. Karafet et al., "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research, 2008] . New binary polymorphisms reshape and increase the resolution of the human Y chromosomal haplogroup tree] .Studies from Volga-Urals on the border of Europe and Asia have revealed high frequencies of R1b1b2 in
Bashkirs , although the genetic diversity is low, suggesting a founder effect. [A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005]ubclades
R1b is a descendant of Haplogroup R1, which is defined by the presence of SNP marker M173. Subclades of R1b per ISOGG 2008 are listed below with their respective SNP markers in parentheses.
*R1b (M343)
**R1b*
**R1b1 (P25)
***R1b1*
***R1b1a (M18)
***R1b1b (P297) Genome Research, [http://www.genome.org/cgi/data/gr.7172008/DC1/1] ]
****R1b1b1 (M73) (formerly R1b1b)
****R1b1b2 (M269, S3, S10, S13, S17) (formerly R1b1c)Thomas Krahn, [http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2008-03/1206567817 Most major R1b1b2 branches are positive for rs34276300 (exceptU106)] ]
*****R1b1b2*
*****R1b1b2a (S127/L11, S128/P311, S129/P310)
******R1b1b2a*
******R1b1b2a1 (M405/S21/U106) (formerly R1b1c9)
*******R1b1b2a1*
*******R1b1b2a1a (M467/S29/U198) (formerly R1b1c9b)
*******R1b1b2a1b (P107)
*******R1b1b2a1c ( [DYS439=null] /L1/S26) (formerly R1b1c9a)
******R1b1b2a2 (S116/rs34276300/P312)
*******R1b1b2a2*
*******R1b1b2a2a ("M37") ("formerly R1b1c1")
*******R1b1b2a2b ("M65") ("formerly R1b1c2")
*******R1b1b2a2c (M153) (formerly R1b1c4)
*******R1b1b2a2d (M167/SRY2627) (formerly R1b1c6)
*******R1b1b2a2e (M222/USP9Y+3636) (formerly R1b1c7)
*******R1b1b2a2f (P66) (formerly R1b1c8)
*******R1b1b2a2g (S28/U152) (formerly R1b1c10)
********R1b1b2a2g1 ("M126") ("formerly R1b1c3")
********R1b1b2a2g2 ("M160") ("formerly R1b1c5")
********R1b1b2a2g3 (L2/S139)
*******R1b1b2a2h (S68) (formerly R1b1c11)
***R1b1c (M335) (formerly R1b1d; location relative to P297 uncertain)R1b1b2
Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1b2
subclade .This subgroup is believed by some to have existed before the last
Ice Age and has been associated with the Aurignacian culture [ [http://www.sciencemag.org/cgi/content/abstract/290/5494/1155?ck=nck "The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective" - Ornella Semino et al., 2000] ] (32,000 - 21,000 BC). Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau [ [http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf "Excavating Y-chromosome haplotype strata in Anatolia", Cinnioglu et al., 2003] ] .Although the precise route of the M269 marker is not known, it is theorized to have originated in Central Asia/South Central Siberia. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia (
Kazakhstan ) via the coasts of theBlack Sea and theBaltic Sea . It is considered widespread in Europe throughout the Paleolithic already before the last Ice Age. [ [http://www.isogg.org/tree/ISOGG_HapgrpR.html International Society of Genetic Genealogy (ISOGG) - haplogroup R] ]Traditionally this culture is associated with the Cro-Magnon people, the first modern humans to enter Europe. However, this view has recently been challenged. [Rapid ecological turnover and its impact on Neanderthal and other human populations - Clive Finlayson and Jose´ S. Carrión, Trends in Ecology & Evolution, Volume 22, Issue 4 , April 2007, Pages 213-222 [http://www.jscarrion.com/pdf/finlayson_carrion.pdf] ] The people of the Aurignacian culture were the first documented human artists, making sophisticated
cave paintings . Famous sites includeLascaux inFrance , Altamira inSpain andValley of Foz Côa inPortugal (the largest open-air site in Europe).The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through
founder effect s andpopulation bottleneck s, as the population became limited to a few coastal refugia in Southern Europe. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian Peninsula (Portugal and Spain), where the R1b1b2 haplogroup may have achieved genetic homogeneity. As conditions eased with theAllerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia toScandinavia , so evident in haplogroup maps. [http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf]A second R1b1b2 population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying
Y-STR markers, appear to have survived alongside other haplogroups in Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1.Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.
(In earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time [from 2003 to 2005] what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c. This shows how nomenclature can evolve as new markers are discovered and then investigated).
R1b1b2a1
The R1b1b2a1 ("formerly R1b1c9") subclade is defined by U106 (also S21 or M405) and appears to be about in over 25% of R1b. It was discovered by Gareth Henson and was quickly set up as a test offered by
EthnoAncestry . This group has a maximum inFrisia (theNetherlands ) and, in general, is the predominant R1b haplogroup. The U106 subclade may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland. [http://www.geocities.com/mcewanjc/s21comment.htm] A close match of the present – day distribution of S21 and the territorial pattern of the EasternCorded Ware culture s and theSingle Grave culture s has been observed. [ [http://www.davidkfaux.org/LaTene_Celt_R1b1c10.pdf] A Genetic Signal of Central European Celtic Ancestry: Preliminary Research Concerning Y-Chromosome Marker S28 / U152 - David K. Faux]In Europe, the subclade (including downstream S29) has a global distribution going north west to east and is found in higher concentrations in
England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in theNetherlands (37.2%) and slopes down to the east throughGermany (20.5%) and theAlps (Switzerland 13.3%,Austria 22.7%) towards theCzech Republic (13.9%) andUkraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% inPoland and 7.2% inRussia . The subclade appears to be omnipresent in Europe, although it becomes less pronounced inIreland (5.9%) andFrance (7.1%) and, further towards theMediterranean , low values are measured inItaly (3.5%), theBalkan andTurkey . [http://www.cmj.hr/2007/48/4/17696299.htm] Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405, The Croatian Medical Journal, Vol. 48, No. 4. (August 2007), pp. 450-459]The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [http://www3.interscience.wiley.com/homepages/38515/pdf/940.pdf] . Family Tree DNA started to test the U152 and U106 on 21 February 2008.
Downsteam of U106, the R1b1b2a1a subclade is defined by U198). It was discovered by [http://ethnoancestry.com/R1b.html EthnoAncestry.] Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Nothing but low values of the marker have been detected over a wide area, that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).
Also downsteam of U106, the R1b1b2a1c subclade is defined by the L1/S26 SNP. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by [http://ethnoancestry.com/R1b.html EthnoAncestry] , is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [http://www.familytreedna.com/public/null439] .
R1b1b2a2
The S116 (rs34276300 = A) SNP is downstream of M269 and upstream of the M37, M65, M153, SRY2627 (M167), M222 and U152 SNPs, but not U106. It appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both
EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of S116 relative to the above list.R1b1b2a2c (M153): This haplogroup has been found so far in 39 individuals, most of them Basques; the rest were likely of Iberian ancestry or have not been classified ethnically [ [http://www.geocities.com/mcewanjc/m153.htm McEwan's Genealogy Page: "R1b1c4 aka M153"] ] . The first time it was located (Bosch 2001 [ [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11254456E. Bosch et al, "High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula", 2001] ] ) it was described as H102 and included 7 Basques and one Andalusian.
R1b1b2a2d (SRY2627 or M167): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999 [ [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=10521311 M.E. Hurles et al, "Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism", 1999] ] . He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish,
Béarn ais, other French, British and Germans.In 2000, Rosser [ [http://www.pubmedcentral.nih.gov/articlerender.fcgi?&pubmedid=11078479 Z.H. Rosser et al, "Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language", 2000] ] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%),
Bavaria ns (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences amongRomania ns,Slovenia ns, Dutch, Belgians and English.In 2001, Bosch [ [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11254456E. Bosch et al "High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula", 2001] ] described this marker as H103, in 5 Basques and 5 Catalans. Further regional studies [ [http://www.geocities.com/mcewanjc/m167.htm McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"] ] have located it in significative amounts in
Asturias ,Cantabria and Galicia, as well as again among Basques. Cases in theAzores andLatin America have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1b2 subclade [ [http://www.geocities.com/mcewanjc/r1bsummary.htm McEwan's Genealogy Page: "Summary of published results in the R subclade"] ] .The subclade R1b1b2a2e (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern
Ireland may be due to positive social selection, as R1b1b2a2e is believed to have been the Y-chromosome haplogroup of the kings of theUí Néill clan of ancient Ireland.The R1b1b2a2g (formerly R1b1c10) subclade is defined by U152 (also called S28) and its discovery was announced in 2005 by [http://ethnoancestry.com/R1b.html EthnoAncestry] . Although sample sizes are relatively small, it appears to reach a maximum in Alpine
Germany andSwitzerland . Ethnoancestry's commercial and research branches have shown that U152 is found fromGreece westward to theBay of Biscay in France. It appears to follow the distribution of theLa Tene Celtic peoples. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both U106 and U152. Like U106, U152's specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently by Sims et al (2007). [http://www.geocities.com/mcewanjc/s28.htm]A recent Y-SNP to surface is S68 defining R1b1b2a2h which was reported by [http://ethnoancestry.com/R1b.html EthnoAncestry] in 2007. It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. [http://ethnoancestry.com/R1b.html EthnoAncestry] has determined that this subclade is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.
Other subclades
Besides the ubiquitous R1b1b2, other subclades descended from haplogroup R1b1 have been identified, including R1b1b1 (M73), R1b1a (M18), and R1b1c (M335). Haplogroup R1b1b1 (M73), which represents the closest patrilineal relatives of haplogroup R1b1b2 (M269), has been found in SE Europe and SW Asia and at generally low frequencies throughout central
Eurasia . Haplogroup R1b1a (M18) has been found only at low frequencies in samples fromSardinia andLebanon . Haplogroup R1b1c-M335 has been identified in Cameroon [http://www.irishtype3dna.org/] Dennis Wright - The Irish Type III Website] and in a sample fromTurkey . [ [http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf] Excavating Y-chromosome haplotype strata in Anatolia - Cengiz Cinnioglu et al., Hum Genet (2004) 114 : 127–148, DOI 10.1007/s00439-003-1031-4]Though African haplogroup R chromosomes are generally quite rare, R-P25* (R1b1*) chromosomes are found at remarkably high frequencies in northern Cameroon (60.7–94.7%), [ [http://hammerlab.biosci.arizona.edu/publications/Wood_2005_EUR.pdf] Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes - Elizabeth T. Wood et al., European Journal of Human Genetics (2005) 13, 867–876] especially among the Ouldeme of Northern
Cameroon in west central Africa, aging at least 4,100 years. [ [http://hpgl.stanford.edu/publications/AJHG_2002_v70_p1197-1214.pdf] A Back Migration from Asia to Sub-Saharan Africa Is Supported by High-Resolution Analysis of Human Y-Chromosome Haplotypes Fulvio Cruciani et al.,Am. J. Hum. Genet. 70:1197–1214, 2002] R1*-M173 are also observed in the Bantu of southern Cameroon (14.3%), Oman (10.7%), Egypt (6.8%), and theHutu (1.4%). Whereas the R1*-M173 undifferentiated lineage is present in all four populations, the two downstream mutations, M17 (R1a1) and M269 (R1b1b2), are confined to Egypt and Oman. It is plausible that the African and Omani R1*-M173 chromosomes may be relics of an ancient back migration from Asia to Africa, which may have been a southern branch of an Upper Paleolithic westward expansion of this clade. The antiquity of the M173 backflow is implied by the total lack in sub-Saharan Africa of downstream mutations R1a1-M17 and R1b1b2-M269, associated with the post–Last Glacial Maximum (LGM) reinhabitation of Eurasia. [ [http://hpgl.stanford.edu/publications/AJHG_2004_v74_p000-0130.pdf] The Levant versus the Horn of Africa: Evidence for Bidirectional Corridors of Human Migrations - J. R. Luis et al., Am. J. Hum. Genet. 74:000–000, 2004]Haplotypes
Modal
Recognizable instances of a
modal haplotype have been noted within the R1b haplogroup.One of the best-characterized of these haplotypes is the
Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and inGreat Britain andIreland . In theIberian Peninsula it reaches 33% inPortugal while the highest value is to be found among Spanish Basques. This has additionally been referenced in literature as Haplotype 15.Another haplotype of R1b, with DYS393=12, has been referenced in the literature as Haplotype 35, or ht35 [http://freepages.genealogy.rootsweb.com/~gallgaedhil/haplo_r1b_ht35.htm Haplogroup R1b (Haplotype 35)] . They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the
Last Glacial Maximum instead of in Iberia. Descendants can be found in high numbers in theArmenian Highland andArmenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 inUyghur populations in western China, which is theorized to be a remnant of theTocharians , an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until later being absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, most likely with the arrival of Roman soldiers.* R1b Modal Haplotype. [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=R1b&viewuid=55GU9&p=0 Ysearch 55GU9 ]
* R1b Modal [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=R1b&viewuid=55GU9&p=0 Ysearch C7BED]
* R1b (NW Irish) Modal [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=modal&viewuid=M5UKQ&p=0 Ysearch M5UKQ ]
* [http://www.ysearch.org/research_comparative.asp?uid=&vallist=+55GU9%2C+C7BED%2C+M5UKQ Comparison]Niall of the Nine Hostages
In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with
Niall of the Nine Hostages , an Irish king in the Early Middle Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1b2a2e.Mutation
The technical details of M343 (rs9786184) are:
:Nucleotide change: C to A:Position (base pair): 402:Total size (base pairs): 424:Forward 5'? 3': tttaacctcctccagctctgca:Reverse 5'? 3': acccccacatatctccagg
This refers to a particular 424
base pair fragment of DNA that thepolymerase chain reaction produces when one uses the two "primer" strands listed.Popular culture
Bryan Sykes , in his book "Blood of the Isles", gives the populations associated with R1b the name ofOisín for a clan patriarch, much as he did for mitochondrial haplogroups in "The Seven Daughters of Eve ".Stephen Oppenheimer also deals with this population group in his book "Origins of the British".See also
*
Human Y-chromosome DNA haplogroup
*Atlantic Modal Haplotype
*Genealogical DNA test
*Prehistoric Europe
*Y-DNA haplogroups by ethnic groups
Y-DNA RReferences
* ISBN 0-691-08750-4
* Michel Morvan (1996) "The linguistic origins of basque" (in french), Bordeaux University Press. ISBN 2-86781-182-1
* Semino et al (2000), [http://hpgl.stanford.edu/publications/Science_2000_v290_p1155.pdf The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans] , Science, Vol 290
* Wells et al (2001), [http://www.pnas.org/cgi/reprint/98/18/10244.pdf The Eurasian Heartland: A continental perspective on Y-chromosome diversity] , PNAS, Vol 98External links
* [http://ethnoancestry.com/R1b.html EthnoAncestry R1b info] / Try here for a map of S21 and S29 frequencies as determined by EthnoAncestry's research arm
* [http://www.isogg.org/tree/ISOGG_HapgrpR08.html International Society of Genetic Genealogy - 2008 tree of haplogroup R]
* [https://www3.nationalgeographic.com/genographic/atlas.html?card=my050 Spread of R1b] , from theGenographic Project , "National Geographic "
* [http://www.vizachero.com/images/R1bClades.pdf R1b1b2 Subclade Maps: M167, M222, S21, S28]
* [http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf World Haplogroup Maps] Note especially the dominance of R1b in Western Europe.
* [http://worldfamilies.net/y-haplogroups.html Worldfamilies.net Page on Haplogroups]
* [http://dgmweb.net/genealogy/DNA/DK/DanishDemes-YDNA-results-HgR1b.shtml Danish Demes Regional DNA Project: Haplogroup R1b]
* [http://www.familytreedna.com/public/null439 null439 project]
* [http://member.tripod.com/~midgley/dna.html Travels on a DNA Molecule] Midgley
* [http://home.cfl.rr.com/wade3/Haplogroup%20R1b.htm Wade Surname Homepage]
* [http://www.dnaheritage.com/ysnpmarkers.asp General SNP Marker Page] DNA Heritage
* [http://www.geocities.com/mcewanjc/ John McEwan's Y Chromosome DNA Genealogy Page]
* [http://www.davidkfaux.org/shetlandhaplogroupR1b David Faux - Haplogroup R1b]
* [http://www.irishtype3dna.org Dennis Wright - Irish Type III Homepage]Maps
* [http://www.relativegenetics.com/genomics/images/haploMaps/originals/R1b_large_RG.jpgMap of R1b]
* [http://mbe.oxfordjournals.org/cgi/content/full/22/10/1964/FIG6 Haplogroup R1b distribution map]
* [http://www.ethnoancestry.com/R1b_map.html EthnoAncestry's Map of R1b with S21, S29 Subclades]Projects
* [http://www.familytreedna.com/public/r1b/ FTDNA Kerchner's R1b and Subclades YDNA Haplogroup Project]
* [http://www.familytreedna.com/public/JewishR1b FTDNA The Jewish R1b Project]
* [http://members.aol.com/chantery/S29DNA/S29.html S29/U198(R1b1b2a1a) project]
Wikimedia Foundation. 2010.